polyglutamine lengths  (Addgene inc)

Journal: Molecular cell

Article Title: Threonine-rich carboxyl-terminal extension drives aggregation of stalled polypeptides.

doi: 10.1016/j.molcel.2024.10.011

Figure Lengend Snippet: Figure 2. Polythreonine forms detergent-insoluble aggregates (A) GFPs with a polyalanine or polythreonine tail were expressed under the GAL1 promoter in WT cells. Cell lysates were analyzed by SDS-PAGE, followed by anti- GFP immunoblotting (IB). Pgk1 served as a loading control. HMW, high-molecular-weight smear. (B) Fluorescence microscopy of WT cells expressing GFPs with the indicated C-terminal tails. White dashed lines indicate cell boundaries. BF, bright field. Scale bar, 5 mm. (C) FRAP analysis of GFP-T30 inclusions. Representative images of pre- and post-bleach are shown, with the photobleached area circled. Scale bar, 1 mm. Graph curves represent mean measurements of 10 inclusions, with error bars indicating SEM. Diffuse GFP-T20 was used as a control. (D) GFPs with C-terminal polythreonine tails were expressed under the GAL1 promoter in WT cells. Detergent-insoluble aggregates tended to stack within polyacrylamide gel pockets. The aggregates were better resolved using SDD-AGE. (E) Fluorescence microscopy of GFPs with polythreonine tails as described in (D). Representative inclusions are shown if detectable. Scale bar, 5 mm. The number of cells with GFP inclusions was counted and is represented in the graph as a percentage of GFP-expressing cells. Mean ± SEM from three biological replicates are shown, with more than 150 cells observed for each tail per biological replicate. (F) FLAG-tagged polythreonine peptides were expressed under the GAL1 promoter in WT cells. Fixed cells were spheroplasted and subjected to immunoflu- orescence microscopy using anti-FLAG antibody (a-FLAG). Scale bar, 5 mm. (G) WT cells expressing FLAG-tagged polythreonine peptides, as described in (F), were lysed and subjected to SDD-AGE and SDS-PAGE, followed by anti-FLAG immunoblotting. (H) Fluorescence microscopy of WT cells expressing GFPs with polythreonine, polyglutamine, and polyasparagine tails. Scale bar, 5 mm.

Article Snippet: Vectors for C-terminal GFP-tagged Huntingtin proteins of various polyglutamine lengths (Htt25Q, Htt46Q, Htt72Q and Htt103Q) were obtained from Addgene (#1185, #15581, #15582 and #1186, respectively) and used directly without modification in yeast.

Techniques: SDS Page, Western Blot, Control, High Molecular Weight, Fluorescence, Microscopy, Expressing

Journal: Molecular cell

Article Title: Threonine-rich carboxyl-terminal extension drives aggregation of stalled polypeptides.

doi: 10.1016/j.molcel.2024.10.011

Figure Lengend Snippet: Figure 5. Polythreonine aggregation in human cells (A) HeLa cells were transfected to express GFPs containing either polyalanine, polythreonine, polyglutamine, or polyserine tails. Nuclei were counterstained with Hoechst and represented in gray in merged images. Scale bar, 15 mm. (B) FRAP analyses of GFP, GFP-T30, and Htt72Q-GFP (huntingtin exon 1 containing a 72-residue-long polyglutamine tract) in HeLa cells. Representative images of GFP-T30 and Htt72Q-GFP inclusions are shown, with photobleached areas circled. Scale bar, 1 mm. Graph curves represent mean measurements of 10 inclusions, with error bars indicating SEM. (C) Lysates of HeLa cells expressing GFPs, with or without the indicated polyamino acid tails, were analyzed by anti-GFP immunoblotting (IB). b-actin served as a loading control. (D) Fluorescence microscopy of GFP or GFP-S30, co-expressed with BFP or BFP-T30 in HeLa cells. Scale bar, 15 mm. (E) FRAP analyses of GFP-S30 co-localized with BFP-T30 inclusions in HeLa cells. Representative images of inclusions are shown, with the photobleached area circled. Scale bar, 1 mm. Graph curves represent mean measurements of 10 inclusions, with error bars indicating SEM. Diffuse GFP-S30 co-expressed with BFP was used as a control. (F) Lysates of HeLa cells expressing GFP-S30 (or GFP) and BFP-T30 (or BFP) were analyzed by SDD-AGE and SDS-PAGE.

Article Snippet: Vectors for C-terminal GFP-tagged Huntingtin proteins of various polyglutamine lengths (Htt25Q, Htt46Q, Htt72Q and Htt103Q) were obtained from Addgene (#1185, #15581, #15582 and #1186, respectively) and used directly without modification in yeast.

Techniques: Transfection, Residue, Expressing, Western Blot, Control, Fluorescence, Microscopy, SDS Page

Journal: Molecular cell

Article Title: Threonine-rich carboxyl-terminal extension drives aggregation of stalled polypeptides.

doi: 10.1016/j.molcel.2024.10.011

Figure Lengend Snippet: Figure 6. Polythreonine aggregates disturb proteostasis (A and B) BFP-T30 was expressed under the GAL1 promoter in cells with the indicated chaperone genes fused to C-terminal mCherry. Nic96-GFP, nuclear marker; BF, bright field. Scale bar, 5 mm. (C) BFP and BFP-T30 were expressed under the GAL1 promoter in WT cells containing the HSR reporter (see Figure 1F). Cells cultured at 25C were analyzed using flow cytometry. Black dot, individual data point; error bar, SEM (n = 3). p value was calculated using Student’s t test (unpaired, two-tailed). (D) GFP-fused huntingtin exon1 (25Q or 103Q) was co-expressed with BFP or BFP-T30 in WT [pin] cells. All constructs were expressed under the GAL1 promoter. Scale bar, 5 mm. (E) Htt103Q-GFP was co-expressed with either BFP or BFP-T30 in [PIN+] and [pin] cells as indicated. Cell lysates were analyzed by anti-GFP and anti-BFP immunoblotting (IB). HMW, high-molecular-weight smear. Pgk1 served as a loading control. (F and G) GFP-fused huntingtin exon 1 (25Q or 46Q) was co-expressed with BFP or BFP-T30 in HEK293T cells (F) for immunoblotting and in HeLa cells (G) for microscopy analyses. Scale bar, 15 mm. (G) Cells with huntingtin inclusions were counted and presented as a percentage of GFP-expressing cells, with means ± SEM from three biological replicates. Over 100 GFP-positive cells were counted per condition in each experiment. p values were obtained by one-way ANOVA.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Northern blot probe to detect tTCGU: TGCCCTCTGTGGGAATTGAACCCA CGATCCCCGCATTACGAGTGCGAT GCCTTACCACTTGGCCAAAAGGGC This paper NP_tT(CGU)K Northern blot probe to detect tTUGU: TGCCACCTGTCAGAATTGAACTAA CGACCTTTGCATTACAAGTGCAAC GCTCTACCACTAAGCTAAGGAGGC This paper NP_tT(UGU)G2 Northern blot probe to detect tRICG (control): CTTCCCCGCCAGGACTTGAACCTGGAAT CTTCTGGTTCGTAGCCAGACGCCGTGAC CATTGGGCCACGAGGAA This paper NP_tR(ACG)D Primer: CATGGATCCTCATGTAGTTGTGGTT GTAGTCGTGGTTGTAGTTTTGTATA GTTCATCCAT This paper R_GFP-T10stop_BamHI: Primer: CATGGATCCTCATGCAGCCGCAGC TGCGGCTGCAGCTGCAGCTTTGTA TAGTTCATCCAT This paper R_GFP-A10stop_BamHI: Primer: AGCAAGCTTTCACGTAGTTGTAGTT GTGGTCGTAGTTGTAGTTGTAGTCG TGGTTGTAGTCGTGGTTGTAGTGGA TCCCTTGTACAGCTC This paper R_GFP-T20stop_BamHI Primer: AGCAAGCTTTCAGGCTGCAGCCGCA GCTGCGGCTGCAGCTGCGGCAGCCG CAGCTGCGGCTGCAGCTGCAGCGGA TCCCTTGTACAGCTC This paper R_GFP-A20stop_BamHI Recombinant DNA p416 25Q GAL Krobitsch et al.91 RRID:Addgene_1185 p416 103Q GAL Krobitsch et al.91 RRID:Addgene_1186 GAL 46Q+ProGFPp416 Duennwald et al.92 RRID:Addgene_15581 GAL 72Q+ProGFPp416 Duennwald et al.92 RRID:Addgene_15582 The full lists of plasmids used in this paper are listed in Tables S2 (Yeast) and S4 (Mammalian) This paper N/A Software and algorithms BioRender BioRender www.biorender.com; RRID:SCR_018361 FIJI Schindelin et al.93 https://imagej.net/software/fiji/; RRID:SCR_002285 FlowJo BD Biosciences RRID:SCR_008520 GraphPad Prism version 10.0.3 GraphPad Software, Boston, Massachusetts USA www.graphpad.com; RRID:SCR_002798 ZEN Blue 3.4 Carl Zeiss, Germany RRID:SCR_013672 R statistical software version 4.4.1 R Project https://www.r-project.org; RRID:SCR_002394 Other Amersham Hybond-N+ Cytiva Cat#RPN303B ChemiDoc MP Imaging System Bio-Rad Cat#12003154 Amersham ImageQuant 800 Fluor Cytiva Cat#29399484 LSM980 with Airyscan2 confocal microscope Zeiss NA Mini Trans-Blota cell Bio-Rad Cat#1703930 Nitrocellulose membrane, 0.45 um Bio-Rad Cat#1620115 (Continued on next page) Molecular Cell 84, 1–16.e1–e7, November 21, 2024 e3

Techniques: Marker, Cell Culture, Cytometry, Two Tailed Test, Construct, Western Blot, High Molecular Weight, Control, Microscopy, Expressing